LAST Tutorial
=============

LAST finds similar regions between sequences, and aligns them.

Example 1: Compare the human and fugu mitochondrial genomes
-----------------------------------------------------------

For our first example, we wish to find and align similar regions
between the human and fugu mitochondrial genomes.  You can find these
sequences in the examples directory: humanMito.fa and fuguMito.fa.  We
can compare them like this::

  lastdb -c humdb humanMito.fa
  lastal humdb fuguMito.fa > myalns.maf

The lastdb command creates several files whose names begin with
"humdb".  The lastal command then compares fuguMito.fa to the humdb
files, and writes the alignments to a file called "myalns.maf".

The -c option causes lowercase letters to be soft-masked.  Lowercase
is often used to indicate repetitive regions, and soft-masking avoids
getting uninteresting repetitive alignments.

Understanding the output
------------------------

The output has very long lines, so you need to view it without
line-wrapping.  For example, with a Unix/Linux/MacOsX command line,
you can use::

  less -S myalns.maf

Each alignment looks like this::

  a score=85
  s humanMito 1742 289 + 16571 AGTATAGGCGATAGAAATTGAAACCTGGCGCAAT...
  s fuguMito  1182 300 + 16447 AGTATAGGAGATAGAAAAGGAA-CTAGGAGCTAT...

The score is a measure of how strong the similarity is.  Lines
starting with "s" contain: the sequence name, the start coordinate of
the alignment, the number of bases spanned by the alignment, the
strand, the sequence length, and the aligned bases.

The start coordinates are zero-based.  This means that, if the
alignment begins right at the start of a sequence, the coordinate is
0.  If the strand is "-", the start coordinate is in the reverse
strand.

This alignment format is called MAF (multiple alignment format), and
it is described in the UCSC Genome FAQ.  You can convert it to several
other formats using maf-convert (see `<maf-convert.html>`_).

Example 2: Compare vertebrate proteins to invertebrate proteins
---------------------------------------------------------------

Use the lastdb -p option to indicate that the sequences are proteins::

  lastdb -p -c invdb invertebrate.fa
  lastal invdb vertebrate.fa

Example 3: Compare DNA sequences to protein sequences
-----------------------------------------------------

Here we use the -F15 option, to specify translated alignment with a
score penalty of 15 for frameshifts::

  lastdb -p -c protdb proteins.fa
  lastal -F15 protdb dnas.fa

Example 4: Calculate E-values of alignment scores
-------------------------------------------------

lastal reports alignments whose score is at least some minimum value,
e.g. 40.  If this value is too high we may miss meaningful alignments,
but if it is too low we may find meaningless alignments.

To solve this dilemma, it is useful to know what alignment scores are
likely between completely random sequences.  For example, let us find
what alignment scores are likely between two random sequences with the
same lengths and base frequencies as the human and fugu mitochondrial
genomes::

  lastdb -x humdb humanMito.fa
  lastdb -x fugdb fuguMito.fa
  lastex humdb.prj fugdb.prj

The lastdb commands count bases, and write them in files called
humdb.prj and fugdb.prj.  The -x option tells it to only count bases
and skip its usual preparation steps.  The lastex command prints a
table of scores and expected numbers of alignments.  Here is an
abbreviated version::

  Score	     Expected number of alignments
  39	     8.44e-11
  22	     0.00805
  20	     0.0699
  12	     398

This tells us, for example, that there will be on average 398
alignments of score 12 or more between random sequences with these
lengths and base frequencies.  Also, 22 is the minimum score such that
the average number of alignments is no more than 0.01.

Finally, we can find alignments with score at least 22 like this::

  lastdb -c humdb humanMito.fa
  lastal -e22 humdb fuguMito.fa > myalns.maf

Example 5: Align human DNA reads to the human genome
----------------------------------------------------

Suppose we have DNA reads in a file called reads.fastq, in
fastq-sanger format.  We can align them to the human genome like
this::

  lastdb -m1111110 humandb human/chr*.fa
  lastal -Q1 -e120 humandb reads.fastq | last-split > myalns.maf

This will use about 15 gigabytes of memory.

* The funny-looking -m1111110 option makes it better at finding short,
  strong alignments.  (The default settings are tuned for long, weak
  alignments.)

* The -Q1 option indicates that the reads are in fastq-sanger format.
  (It also changes the scoring scheme: more on this below.)

* The -e120 option requests alignments with score >= 120.  This is
  intentionally a somewhat low score (high E-value): last-split then
  discards alignments with score < 150 (120+30), but it uses them to
  estimate the ambiguity of alignments with score >= 150.

* last-split reads the alignments produced by lastal, and looks for a
  unique best alignment for each part of each read.  It allows
  different parts of one read to match different parts of the genome.
  It has several useful options, please see `<last-split.html>`_.

If you have paired reads, there are two options:

1. Use last-pair-probs (see `<last-pair-probs.html>`_).

2. Ignore the pairing information, and align the reads individually
   (using last-split as above).  This may be useful because
   last-pair-probs does not currently allow different parts of one
   read to match different parts of the genome, though it does allow
   the two reads in a pair to match (e.g.) different chromosomes.

Fastq format confusion
----------------------

Unfortunately, there is more than one fastq format (see
http://nar.oxfordjournals.org/content/38/6/1767.long).  Recently
(2013) fastq-sanger seems to be dominant, but if you have another
variant you need to change the -Q option (see `<lastal.txt>`_).

Alignment scoring schemes
-------------------------

The default DNA scoring scheme used by lastal is tuned for finding
long, weak alignments.  It is::

  match score = 1,  mismatch cost = 1,  gap cost = 7 + 1 * (gap length),

However, if you use option -Q1, it uses a different scoring scheme
tuned for finding short, strong alignments::

  match score = 6,  mismatch cost = 18,  gap cost = 21 + 9 * (gap length),

In the next two examples, we set the scoring scheme by hand.

Example 6: Align human fasta reads to the human genome
------------------------------------------------------

Suppose we have DNA reads in fasta format (without quality data)
instead of fastq.  We need to omit the -Q option, but we wish to use
the same scoring scheme as -Q1::

  lastdb -m1111110 humandb human/chr*.fa
  lastal -r6 -q18 -a21 -b9 -e120 humandb reads.fa | last-split > myalns.maf

Example 7: Align aardvark fastq reads to the human genome
---------------------------------------------------------

In this case we need to use the -Q option, but we wish to find weak
alignments::

  lastdb -c humandb human/chr*.fa
  lastal -Q1 -r5 -q5 -a35 -b5 humandb reads.fastq > myalns.maf

This example uses a scaled version of the default alignment scores
(1:1:7:1 -> 5:5:35:5).  The reason for this is to put them on roughly
the same scale as the fastq quality scores.

lastal uses the quality scores to modify the alignment scores, and
then rounds the modified scores to integers.  By using scaled
alignment scores, we reduce the information loss caused by rounding.

Very short reads
----------------

WARNING!  The standard score parameters do not align very short reads.
This is because the match score is 6 and the score threshold is 150,
so at least 25 high-quality matches are required (or a greater number
of low-quality matches).  To align very short reads, reduce the score
threshold (lastal -e and/or last-split -s).

If the score threshold is too low, you will get meaningless, random
alignments.

Trading speed for sensitivity
-----------------------------

You can make LAST more sensitive, at the expense of speed, by
increasing lastal's m parameter.  The default value is 10.  So -m100
makes it more slow and sensitive, and -m1000 makes it much more slow
and sensitive.

Example 8: Compare the cat and mouse genomes
--------------------------------------------

If you have ~50 GB of memory and don't mind waiting a few days, this
is a good way to compare such genomes::

  lastdb -c -uMAM8 mousedb mouse/chr*.fa
  lastal -e34 -m100 mousedb cat/chr*.fa | last-split > myalns.maf

This looks for a unique best alignment for each part of each cat
chromosome.  Omitting -m100 makes it faster but somewhat less
sensitive.  Omitting -uMAM8 reduces the memory use to ~10 GB and makes
it faster but considerably less sensitive.

Going faster by using multiple CPUs
-----------------------------------

If you have more than one query sequence, you can go faster by
aligning them in parallel.  This can be done with parallel-fasta and
parallel-fastq (which accompany LAST, but require GNU parallel to be
installed: http://www.gnu.org/software/parallel/).  These commands
read sequence data, split it into blocks (with a whole number of
sequences per block), and run the blocks in parallel through any
command or pipeline you specify, using all your CPU cores.  Here are
some examples.

Instead of this::

  lastal mydb queries.fa > myalns.maf

try this::

  parallel-fasta "lastal mydb" < queries.fa > myalns.maf

Instead of this::

  lastal -Q1 -e120 db q.fastq | last-split > out.maf

try this::

  parallel-fastq "lastal -Q1 -e120 db | last-split" < q.fastq > out.maf

Instead of this::

  zcat queries.fa.gz | lastal mydb > myalns.maf

try this::

  zcat queries.fa.gz | parallel-fasta "lastal mydb" > myalns.maf

Notes:

* parallel-fasta and parallel-fastq simply execute GNU parallel with a
  few options for fasta or fastq: you can specify other GNU parallel
  options to control the number of simultaneous jobs, use remote
  computers, get the output in the same order as the input, etc.

* parallel-fastq assumes that each fastq record is 4 lines, so there
  should be no line wrapping or blank lines.

Example 9: Ambiguity of alignment columns
-----------------------------------------

Consider this alignment::

  TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
  |||||||| ||||||  |  ||  | |  |    || ||||||   |||||||||||
  TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG

The middle section has such weak similarity that its precise alignment
cannot be confidently inferred.

It is sometimes useful to estimate the ambiguity of each column in an
alignment.  We can do that using lastal option -j4::

  lastdb -c humdb humanMito.fa
  lastal -j4 humdb fuguMito.fa > myalns.maf

The output looks like this::

  a score=17
  s seqX 0 57 + 57 TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
  s seqY 0 51 + 51 TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG
  p                %*.14442011.(%##"%$$$$###""!!!""""&'(*,340.,,.~~~~~~~~~~~

The "p" line indicates the probability that each column is wrongly
aligned, using a compact code (the same as fastq-sanger format):

  ======  =================   ======  =================
  Symbol  Error probability   Symbol  Error probability
  ------  -----------------   ------  -----------------
  ``!``   0.79 -- 1           ``0``   0.025 -- 0.032
  ``"``   0.63 -- 0.79        ``1``   0.02  -- 0.025
  ``#``   0.5  -- 0.63        ``2``   0.016 -- 0.02
  ``$``   0.4  -- 0.5         ``3``   0.013 -- 0.016
  ``%``   0.32 -- 0.4         ``4``   0.01  -- 0.013
  ``&``   0.25 -- 0.32        ``5``   0.0079 -- 0.01
  ``'``   0.2  -- 0.25        ``6``   0.0063 -- 0.0079
  ``(``   0.16 -- 0.2         ``7``   0.005  -- 0.0063
  ``)``   0.13 -- 0.16        ``8``   0.004  -- 0.005
  ``*``   0.1  -- 0.13        ``9``   0.0032 -- 0.004
  ``+``   0.079 -- 0.1        ``:``   0.0025 -- 0.0032
  ``,``   0.063 -- 0.079      ``;``   0.002  -- 0.0025
  ``-``   0.05  -- 0.063      ``<``   0.0016 -- 0.002
  ``.``   0.04  -- 0.05       ``=``   0.0013 -- 0.0016
  ``/``   0.032 -- 0.04       ``>``   0.001  -- 0.0013
  ======  =================   ======  =================

Note that each alignment is grown from a "core" region, and the
ambiguity estimates assume that the core is correctly aligned.  The
core is indicated by "~" symbols, and it contains exact matches only.

LAST has options to find alignments with optimal column probabilities,
instead of optimal score: see `<lastal.txt>`_.
